Rat MBL-1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:RGE714-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
717bp
Gene Synonym
Mbpa, Mlb1, Mbl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat mannose-binding lectin (protein A) 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Mannose-binding lectin (MBL), also named mannose or mannan-binding protein (MBP), is a C-type lectin which participates in the innate immune system as an activator of the complement system and as opsonin after binding to certain carbohydrate structures on microorganisms and pathogens. Its function appears to be pattern recognition in the first line of defense in the pre-immune host. MBL recognizes carbohydrate patterns found on the surface of a large number of pathogenic micro-organisms including bacteria, viruses, protozoa and fungi. Binding of MBL to a micro-organism results in activation of the lectin pathway of the complement system. Two forms of MBL, MBL-A and MBL-C, were characterized in rodents, rabbits, bovine and rhesus monkeys, whereas only one form was identified in humans, chimpanzees and chickens. The two forms are encoded by two distinct genes named MBL1 and MBL2, which have been identified in many species including the pig. The MBL1 and MBL2 genes encode mannan-binding lectins (MBL) A and C, respectively, that are collagenous lectins (collectins) produced mainly by the liver. The MBL1 gene encodes MBL-A, which has bacteria-binding properties in pigs and rodents but is mutated to a pseudogene in humans and chimpanzees. Deficiency of MBL is probably the most common human immunodeficiency and is associated with an increased risk of mucosally acquired infections including meningococcal disease. MBL could modify disease susceptibility by modulating macrophage interactions with mucosal organisms at the site of initial acquisition.
References
  • Jack DL, et al. (2005) Mannose-binding lectin enhances phagocytosis and killing of Neisseria meningitidis by human macrophages. J Leukoc Biol. 77(3): 328-36.
  • Lillie BN, et al. (2006) Single-nucleotide polymorphisms in porcine mannan-binding lectin A. Immunogenetics. 58(12): 983-93.
  • Nikolakopoulou K, et al. (2006) Molecular cloning and characterisation of two homologues of Mannose-Binding Lectin in rainbow trout. Fish Shellfish Immunol. 21(3): 305-14.
  • Phatsara C, et al. (2007) Molecular genetic analysis of porcine mannose-binding lectin genes, MBL1 and MBL2, and their association with complement activity. Int J Immunogenet. 34(1): 55-63.
  • TOP