Rat MBL-1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_012599.2

RefSeq ORF Size

717bp

Gene Synonym

Mbpa, Mlb1, Mbl1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat mannose-binding lectin (protein A) 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Mannose-binding lectin (MBL), also named mannose or mannan-binding protein (MBP), is a C-type lectin which participates in the innate immune system as an activator of the complement system and as opsonin after binding to certain carbohydrate structures on microorganisms and pathogens. Its function appears to be pattern recognition in the first line of defense in the pre-immune host. MBL recognizes carbohydrate patterns found on the surface of a large number of pathogenic micro-organisms including bacteria, viruses, protozoa and fungi. Binding of MBL to a micro-organism results in activation of the lectin pathway of the complement system. Two forms of MBL, MBL-A and MBL-C, were characterized in rodents, rabbits, bovine and rhesus monkeys, whereas only one form was identified in humans, chimpanzees and chickens. The two forms are encoded by two distinct genes named MBL1 and MBL2, which have been identified in many species including the pig. The MBL1 and MBL2 genes encode mannan-binding lectins (MBL) A and C, respectively, that are collagenous lectins (collectins) produced mainly by the liver. The MBL1 gene encodes MBL-A, which has bacteria-binding properties in pigs and rodents but is mutated to a pseudogene in humans and chimpanzees. Deficiency of MBL is probably the most common human immunodeficiency and is associated with an increased risk of mucosally acquired infections including meningococcal disease. MBL could modify disease susceptibility by modulating macrophage interactions with mucosal organisms at the site of initial acquisition.

References

Jack DL, et al. (2005) Mannose-binding lectin enhances phagocytosis and killing of Neisseria meningitidis by human macrophages. J Leukoc Biol. 77(3): 328-36.

Lillie BN, et al. (2006) Single-nucleotide polymorphisms in porcine mannan-binding lectin A. Immunogenetics. 58(12): 983-93.

Nikolakopoulou K, et al. (2006) Molecular cloning and characterisation of two homologues of Mannose-Binding Lectin in rainbow trout. Fish Shellfish Immunol. 21(3): 305-14.

Phatsara C, et al. (2007) Molecular genetic analysis of porcine mannose-binding lectin genes, MBL1 and MBL2, and their association with complement activity. Int J Immunogenet. 34(1): 55-63.

Catalog Number:RGE714-CF