Rat KIRREL3/NEPH2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:RGE171-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2301bp
Gene Synonym
Kirrel3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat kin of IRRE like 3 (Drosophila) Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Kin of IRRE-like protein 3 (KIRREL3) also known as nin of irregular chiasm-like protein 3 or nephrin-like protein 2 (NEPH2) is a member of the nephrin-like protein family of transmembrane proteins, which includes NEPH1 (KIRREL) and NEPH3 (KIRREL2). KIRREL3/NEPH2 is expressed in fetalv and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of KIRREL3/NEPH2 interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in KIRREL3/NEPH2 are associated with mental retardation autosomal dominant type 4. KIRREL3/NEPH2 expression is turned on in migrating nucleogenesis of the pontine nucleus (PN) neurons only after they enter the presumptive nuclear region. KIRREL3/NEPH2 knockdown disrupted the nuclear organization of PN presumably by changing the migratory behavior of PN neurons inside the nuclear region. Moreover, overexpression of the cytoplasmic region of KIRREL3, which can sequester intracellular signaling of endogenous KIRREL3, resulted in similar phenotypes. Overall, these results suggest KIRREL3 is involved in the nucleogenesis of the PN through the control of neuronal migration inside the nucleus.
References
  • Bhalla K, et al. (2008) Alterations in CDH15 and KIRREL3 in patients with mild to severe intellectual disability. Am J Hum Genet. 83(6): 703-13.
  • Gerke P, et al. (2005) NEPH2 is located at the glomerular slit diaphragm, interacts with nephrin and is cleaved from podocytes by metalloproteinases. J Am Soc Nephrol. 16(6): 1693-702.
  • Gerke P, et al. (2006) Neuronal expression and interaction with the synaptic protein CASK suggest a role for Neph1 and Neph2 in synaptogenesis. J Comp Neurol. 498(4): 466-75.
  • TOP