Rat KIRREL3/NEPH2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:RGE171-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2301bp
Gene Synonym
Kirrel3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat kin of IRRE like 3 (Drosophila) Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Kin of IRRE-like protein 3 (KIRREL3) also known as nin of irregular chiasm-like protein 3 or nephrin-like protein 2 (NEPH2) is a member of the nephrin-like protein family of transmembrane proteins, which includes NEPH1 (KIRREL) and NEPH3 (KIRREL2). KIRREL3/NEPH2 is expressed in fetalv and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of KIRREL3/NEPH2 interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in KIRREL3/NEPH2 are associated with mental retardation autosomal dominant type 4. KIRREL3/NEPH2 expression is turned on in migrating nucleogenesis of the pontine nucleus (PN) neurons only after they enter the presumptive nuclear region. KIRREL3/NEPH2 knockdown disrupted the nuclear organization of PN presumably by changing the migratory behavior of PN neurons inside the nuclear region. Moreover, overexpression of the cytoplasmic region of KIRREL3, which can sequester intracellular signaling of endogenous KIRREL3, resulted in similar phenotypes. Overall, these results suggest KIRREL3 is involved in the nucleogenesis of the PN through the control of neuronal migration inside the nucleus.
References
  • Bhalla K, et al. (2008) Alterations in CDH15 and KIRREL3 in patients with mild to severe intellectual disability. Am J Hum Genet. 83(6): 703-13.
  • Gerke P, et al. (2005) NEPH2 is located at the glomerular slit diaphragm, interacts with nephrin and is cleaved from podocytes by metalloproteinases. J Am Soc Nephrol. 16(6): 1693-702.
  • Gerke P, et al. (2006) Neuronal expression and interaction with the synaptic protein CASK suggest a role for Neph1 and Neph2 in synaptogenesis. J Comp Neurol. 498(4): 466-75.
  • TOP