Rat IL-21R Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001012469.1

RefSeq ORF Size

1566bp

Gene Synonym

MGC108921, Il21r

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 21 receptor Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin-21 receptor, also known as IL-21 receptor, IL-21R, Novel interleukin receptor, IL21R and NILR, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 4 subfamily. Interleukin-21 (IL-21) belongs to a family of cytokines that bind to a composite receptor consisting of a private receptor (IL-21R) and the common cytokine receptor gamma chain ( gamma(C) ). The IL-21R is discovered as a novel member of the class-I-cytokine-receptor family and is selectively expressed in lymphoid tissues. IL-21R shows strong sequence homologies to the interleukin-4 receptor alpha chain gene (IL-4RA). The WSXWS motif of IL-21R appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box 1 motif of IL-21R is required for JAK interaction and / or activation. The IL-21R is widely distributed on lympho-haematopoietic cells and IL21 impacts a number of cell types, including CD8+ memory T cells, NK cells and subsets of CD4 memory T cells. Increased IL21 production is characteristic of certain autoimmune diseases and is likely to contribute to autoantibody production as well as pathological features of autoimmune disease. The critical role of IL21 in promoting humoral immune responses makes it an important focus of potential therapeutic interventions in conditions characterised by overproduction of pathogenic autoantibodies.

References

Asao H, et al. (2001) Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex. J Immunol. 167(1): 1-5.

Wu Z, et al. (2005) Interleukin-21 receptor gene induction in human T cells is mediated by T-cell receptor-induced Sp1 activity. Mol Cell Biol. 25(22): 9741-52.

De Totero D, et al. (2006) Interleukin-21 receptor (IL-21R) is up-regulated by CD40 triggering and mediates proapoptotic signals in chronic lymphocytic leukemia B cells. Blood. 107(9): 3708-15.

Catalog Number:RGD890-NF