Rat IL-21R Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:RGD890-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1566bp
Gene Synonym
MGC108921, Il21r
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 21 receptor Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-21 receptor, also known as IL-21 receptor, IL-21R, Novel interleukin receptor, IL21R and NILR, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 4 subfamily. Interleukin-21 (IL-21) belongs to a family of cytokines that bind to a composite receptor consisting of a private receptor (IL-21R) and the common cytokine receptor gamma chain ( gamma(C) ). The IL-21R is discovered as a novel member of the class-I-cytokine-receptor family and is selectively expressed in lymphoid tissues. IL-21R shows strong sequence homologies to the interleukin-4 receptor alpha chain gene (IL-4RA). The WSXWS motif of IL-21R appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box 1 motif of IL-21R is required for JAK interaction and / or activation. The IL-21R is widely distributed on lympho-haematopoietic cells and IL21 impacts a number of cell types, including CD8+ memory T cells, NK cells and subsets of CD4 memory T cells. Increased IL21 production is characteristic of certain autoimmune diseases and is likely to contribute to autoantibody production as well as pathological features of autoimmune disease. The critical role of IL21 in promoting humoral immune responses makes it an important focus of potential therapeutic interventions in conditions characterised by overproduction of pathogenic autoantibodies.
References
  • Asao H, et al. (2001) Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex. J Immunol. 167(1): 1-5.
  • Wu Z, et al. (2005) Interleukin-21 receptor gene induction in human T cells is mediated by T-cell receptor-induced Sp1 activity. Mol Cell Biol. 25(22): 9741-52.
  • De Totero D, et al. (2006) Interleukin-21 receptor (IL-21R) is up-regulated by CD40 triggering and mediates proapoptotic signals in chronic lymphocytic leukemia B cells. Blood. 107(9): 3708-15.
  •  

    TOP