Rat Ephrin B3 / EFNB3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGC547-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1023bp
Gene Synonym
ELK-L3, RGD1565678, Efnb3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat ephrin B3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ephrin B3 belongs to the ephrin family. Ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. Ephrin B3 is important in brain development as well as in its maintenance. It is especially important for forebrain function since its expression levels were particularly high in several forebrain subregions compared to other brain subregions. Ephrin B3 binds to, and induce the collapse of, commissural axons/growth cones in vitro. It may play a role in constraining the orientation of longitudinally projecting axons.
References
  • Takemoto M, et al. (2002) Ephrin-B3-EphA4 interactions regulate the growth of specific thalamocortical axon populations in vitro. Eur J Neurosci. 16(6):1168-72.
  • Brckner K, et al. (1999) EphrinB ligands recruit GRIP family PDZ adaptor proteins into raft membrane microdomains. Neuron. 22(3):511-24.
  • Bergemann A, et al. (1998) Ephrin-B3, a ligand for the receptor EphB3, expressed at the midline of the developing neural tube. Oncogene. 16(4):471-80.
  • TOP