Rat Ephrin B3 / EFNB3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGC547-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1023bp
Gene Synonym
ELK-L3, RGD1565678, Efnb3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat ephrin B3 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ephrin B3 belongs to the ephrin family. Ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. Ephrin B3 is important in brain development as well as in its maintenance. It is especially important for forebrain function since its expression levels were particularly high in several forebrain subregions compared to other brain subregions. Ephrin B3 binds to, and induce the collapse of, commissural axons/growth cones in vitro. It may play a role in constraining the orientation of longitudinally projecting axons.
References
  • Takemoto M, et al. (2002) Ephrin-B3-EphA4 interactions regulate the growth of specific thalamocortical axon populations in vitro. Eur J Neurosci. 16(6):1168-72.
  • Brckner K, et al. (1999) EphrinB ligands recruit GRIP family PDZ adaptor proteins into raft membrane microdomains. Neuron. 22(3):511-24.
  • Bergemann A, et al. (1998) Ephrin-B3, a ligand for the receptor EphB3, expressed at the midline of the developing neural tube. Oncogene. 16(4):471-80.
  • TOP