Rat DDR2/CD167b Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_031764.3

RefSeq ORF Size

2565bp

Gene Synonym

Tyro10, Ddr2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat discoidin domain receptor tyrosine kinase 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind of protein tyrosine kinases associated with cell proliferation and tumor metastasis, and collagen, identified as a ligand for DDR2, up-regulates matrix metallloproteinase 1 (MMP-1) and MMP-2 expression in cellular matrix. DDR2/CD167b was found to recognise the triple-helical region of collagen X as well as the NC1 domain. Binding to the collagenous region was dependent on the triple-helical conformation. DDR2/CD167b autophosphorylation was induced by the collagen X triple-helical region but not the NC1 domain, indicating that the triple-helical region of collagen X contains a specific DDR2 binding site that is capable of receptor activation. DDR2/CD167b is induced during stellate cell activation and implicate the phosphorylated receptor as a mediator of MMP-2 release and growth stimulation in response to type I collagen. Moreover, type I collagen-dependent upregulation of DDR2/CD167b expression establishes a positive feedback loop in activated stellate cells, leading to further proliferation and enhanced invasive activity.

References

Olaso E, et al. (2001) DDR2 receptor promotes MMP-2-mediated proliferation and invasion by hepatic stellate cells. J Clin Invest. 108(9): 1369-78.

Zhang W, et al. (2006) Expression of discoidin domain receptor 2 (DDR2) extracellular domain in pichia pastoris and functional analysis in synovial fibroblasts and NIT3T3 cells. Mol Cell Biochem. 290(1-2): 43-53.

Leitinger B, et al. (2006) The discoidin domain receptor DDR2 is a receptor for type X collagen. Matrix Biol. 25(6): 355-64.

Leitinger B, et al. (2004) The D2 period of collagen II contains a specific binding site for the human discoidin domain receptor, DDR2. J Mol Biol. 344(4): 993-1003.

Catalog Number:RGC116-CY