Rat DDR2/CD167b Gene ORF cDNA clone expression plasmid,C terminal His tag

Gene

Species

Rat

NCBI Ref Seq

NM_031764.3

RefSeq ORF Size

2565bp

Gene Synonym

Tyro10, Ddr2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat discoidin domain receptor tyrosine kinase 2 Gene ORF cDNA clone expression plasmid,C terminal His tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-His

Restriction Site

Protein Tag

His

Tag Sequence

CACCATCACCACCATCATCACCACCATCAC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind of protein tyrosine kinases associated with cell proliferation and tumor metastasis, and collagen, identified as a ligand for DDR2, up-regulates matrix metallloproteinase 1 (MMP-1) and MMP-2 expression in cellular matrix. DDR2/CD167b was found to recognise the triple-helical region of collagen X as well as the NC1 domain. Binding to the collagenous region was dependent on the triple-helical conformation. DDR2/CD167b autophosphorylation was induced by the collagen X triple-helical region but not the NC1 domain, indicating that the triple-helical region of collagen X contains a specific DDR2 binding site that is capable of receptor activation. DDR2/CD167b is induced during stellate cell activation and implicate the phosphorylated receptor as a mediator of MMP-2 release and growth stimulation in response to type I collagen. Moreover, type I collagen-dependent upregulation of DDR2/CD167b expression establishes a positive feedback loop in activated stellate cells, leading to further proliferation and enhanced invasive activity.

References

Olaso E, et al. (2001) DDR2 receptor promotes MMP-2-mediated proliferation and invasion by hepatic stellate cells. J Clin Invest. 108(9): 1369-78.

Zhang W, et al. (2006) Expression of discoidin domain receptor 2 (DDR2) extracellular domain in pichia pastoris and functional analysis in synovial fibroblasts and NIT3T3 cells. Mol Cell Biochem. 290(1-2): 43-53.

Leitinger B, et al. (2006) The discoidin domain receptor DDR2 is a receptor for type X collagen. Matrix Biol. 25(6): 355-64.

Leitinger B, et al. (2004) The D2 period of collagen II contains a specific binding site for the human discoidin domain receptor, DDR2. J Mol Biol. 344(4): 993-1003.

Catalog Number:RGC116-CH