Rat Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:RGB723-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1449bp
Gene Synonym
F10
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat coagulation factor X Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme of the coagulation cascade. It is one of the vitamin K-dependent serine proteases, and plays a crucial role in the coagulation cascade and blood clotting, as the first enzyme in the common pathway of thrombus formation. Factor X deficiency is one of the rarest of the inherited coagulation disorders. FX deficiency among the most severe of the rare coagulation defects, typically including hemarthroses, hematomas, and umbilical cord, gastrointestinal, and central nervous system bleeding. Factor X is synthesized in the liver as a mature heterodimer formed from a single-chain precursor, and vitamin K is essential for its synthesis. Factor X is activated into factor Xa (FXa) by both factor IX (with its cofactor, factor VIII in a complex known as intrinsic Xase) and factor VII (with its cofactor, tissue factor in a complex known as extrinsic Xase) through cleaving the activation propeptide. As the first member of the final common pathway or thrombin pathway, FXa converts prothrombin to thrombin in the presence of factor Va, Ca2+, and phospholipid during blood clotting and cleaves prothrombin in two places (an arg-thr and then an arg-ile bond). This process is optimized when factor Xa is complexed with activated cofactor V in the prothrombinase complex. Inborn deficiency of factor X is very uncommon, and may present with epistaxis (nose bleeds), hemarthrosis (bleeding into joints) and gastrointestinal blood loss. Apart from congenital deficiency, low factor X levels may occur occasionally in a number of disease states. Furhermore, factor X deficiency may be seen in amyloidosis, where factor X is adsorbed to the amyloid fibrils in the vasculature.
References
  • Rosen ED. (2002) Gene targeting in hemostasis. Factor X. Front Biosci. 7: d1915-25.
  • Uprichard J, et al. (2002) Factor X deficiency. Blood Rev. 16(2): 97-110.
  • Borensztajn K, et al. (2008) Factor Xa: at the crossroads between coagulation and signaling in physiology and disease. Trends Mol Med. 14(10): 429-40.
  • Menegatti M, et al. (2009) Factor X deficiency. Semin Thromb Hemost. 35(4): 407-15.
  • TOP