Rat Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_017143.2

RefSeq ORF Size

1449bp

Gene Synonym

F10

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat coagulation factor X Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme of the coagulation cascade. It is one of the vitamin K-dependent serine proteases, and plays a crucial role in the coagulation cascade and blood clotting, as the first enzyme in the common pathway of thrombus formation. Factor X deficiency is one of the rarest of the inherited coagulation disorders. FX deficiency among the most severe of the rare coagulation defects, typically including hemarthroses, hematomas, and umbilical cord, gastrointestinal, and central nervous system bleeding. Factor X is synthesized in the liver as a mature heterodimer formed from a single-chain precursor, and vitamin K is essential for its synthesis. Factor X is activated into factor Xa (FXa) by both factor IX (with its cofactor, factor VIII in a complex known as intrinsic Xase) and factor VII (with its cofactor, tissue factor in a complex known as extrinsic Xase) through cleaving the activation propeptide. As the first member of the final common pathway or thrombin pathway, FXa converts prothrombin to thrombin in the presence of factor Va, Ca2+, and phospholipid during blood clotting and cleaves prothrombin in two places (an arg-thr and then an arg-ile bond). This process is optimized when factor Xa is complexed with activated cofactor V in the prothrombinase complex. Inborn deficiency of factor X is very uncommon, and may present with epistaxis (nose bleeds), hemarthrosis (bleeding into joints) and gastrointestinal blood loss. Apart from congenital deficiency, low factor X levels may occur occasionally in a number of disease states. Furhermore, factor X deficiency may be seen in amyloidosis, where factor X is adsorbed to the amyloid fibrils in the vasculature.

References

Rosen ED. (2002) Gene targeting in hemostasis. Factor X. Front Biosci. 7: d1915-25.

Uprichard J, et al. (2002) Factor X deficiency. Blood Rev. 16(2): 97-110.

Borensztajn K, et al. (2008) Factor Xa: at the crossroads between coagulation and signaling in physiology and disease. Trends Mol Med. 14(10): 429-40.

Menegatti M, et al. (2009) Factor X deficiency. Semin Thromb Hemost. 35(4): 407-15.

Catalog Number:RGB723-CM