Rat CNTF/Ciliary Neurotrophic Factor Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:RGB710-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
603bp
Gene Synonym
Cntf
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat ciliary neurotrophic factor Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ciliary neurotrophic factor (CNTF) is a member of the cytokine family. It is a polypeptide hormone that have functions in promoting neurotransmitter synthesis and neurite outgrowth in certain neuronal populations. It's actions appear to be restricted to the nervous system. Ciliary neurotrophic factor (CNTF) has biological effects through the activation of a multi- subunit receptor complex, consisting of an extracelluar CNTF binding subunit (CNTFα) and two transmembrane signal transduction proteins: glycoprotein gp130 and LIF receptor. CNTF is considered as a potent survival factor of neurons and oligodendrocyteands may be relevant in reducing tissue destruction during inflammatory attacks. CNTF also is a survival factor for neurons of the peripheral sensory sympathetic and ciliary ganglia. It has been reported that CNTF could be an agent that has therapeutic potential and possibly induces differentiation of large multipolar ganglionic phenotype in a subset of progenitors.
References
  • Dutt K, et al. (2010) Ciliary neurotrophic factor: a survival and differentiation inducer in human retinal progenitors. In Vitro Cell Dev Biol Anim. 46 (7) : 635-46.
  • Lam A, et al.(1991) Sequence and structural organization of the human gene encoding ciliary neurotrophic factor. Gene 102 (2) : 271–6.
  • Bazan JF. ( 1991) Neuropoietic cytokines in the hematopoietic fold. Neuron 7 (2) : 197–208.
  •  

     

    CNTF related areas, pathways, and other information

    TOP