Rat CNTF/Ciliary Neurotrophic Factor Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:RGB710-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
603bp
Gene Synonym
Cntf
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat ciliary neurotrophic factor Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ciliary neurotrophic factor (CNTF) is a member of the cytokine family. It is a polypeptide hormone that have functions in promoting neurotransmitter synthesis and neurite outgrowth in certain neuronal populations. It's actions appear to be restricted to the nervous system. Ciliary neurotrophic factor (CNTF) has biological effects through the activation of a multi- subunit receptor complex, consisting of an extracelluar CNTF binding subunit (CNTFα) and two transmembrane signal transduction proteins: glycoprotein gp130 and LIF receptor. CNTF is considered as a potent survival factor of neurons and oligodendrocyteands may be relevant in reducing tissue destruction during inflammatory attacks. CNTF also is a survival factor for neurons of the peripheral sensory sympathetic and ciliary ganglia. It has been reported that CNTF could be an agent that has therapeutic potential and possibly induces differentiation of large multipolar ganglionic phenotype in a subset of progenitors.
References
  • Dutt K, et al. (2010) Ciliary neurotrophic factor: a survival and differentiation inducer in human retinal progenitors. In Vitro Cell Dev Biol Anim. 46 (7) : 635-46.
  • Lam A, et al.(1991) Sequence and structural organization of the human gene encoding ciliary neurotrophic factor. Gene 102 (2) : 271–6.
  • Bazan JF. ( 1991) Neuropoietic cytokines in the hematopoietic fold. Neuron 7 (2) : 197–208.
  •  

     

    CNTF related areas, pathways, and other information

    TOP