Rat CLEC4B2 / mDCAR1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:RGB645-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
627bp
Gene Synonym
Aplra1, Clec4b2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat C-type lectin domain family 4, member B2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Clec4b2, also known as mDCAR1, is a member of the DCIR/DCAR family. Expression of Clec4b2 was strongly tissue dependent. Clec4b2 expression on DCs was restricted to the CD8(+) DC subset in spleen and thymus and on subpopulations of CD11b(+) myeloid cells in bone marrow and spleen, whereas the molecule was not detectable on both cell types in lymph nodes and peripheral blood. Clec4b2 is a functional receptor on cells of the immune system and provides further insights into the regulation of immune responses by CLRs.
References
  • Katayama S. et al., 2005, Science. 309 (5740): 1564-6.
  • Kaden SA. et al., 2009, J Immunol. 183 (8): 5069-78.
  • Skarnes WC. et al., 2011, Nature. 474 (7351): 337-42.
  • TOP