Rat CD302/CLEC13A Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGB332-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
687bp
Gene Synonym
MGC108799, RGD1307606, Cd302
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat CD302 molecule Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD302/CLEC13A (C-type lectin domain family 13 member A), also known as C-type lectin receptor DCL-1, is a type I transmembrane C-type lectin DCL-1/CD302. DCL-1 protein was highly conserved among the human, mouse, and rat orthologs. DCL-1 ectodomain contains only one CRD, whereas other type I transmembrane C-type lectins contain more than one domain (e.g. selectins and MMR). DCL-1 CP contains several putative motifs, including a Tyr-based internalization, a cluster of acidic amino acids, and Ser and Tyr phosphorylation motifs, suggesting that DCL-1 CP mediates not only endocytosis and late endosome targeting but also signaling. DCL-1 may be another cell/matrix adhesion receptor integrated in cell adhesion complexes and that DCL-1 dysfunction may affect APC adhesion and migration, causing suppression of APC function.
References
  • Kato M, et al. (2007) The novel endocytic and phagocytic C-Type lectin receptor DCL-1/CD302 on macrophages is colocalized with F-actin, suggesting a role in cell adhesion and migration. J Immunol. 179(9): 6052-63.
  • Skinnider BF, et al. (2002) The role of cytokines in classical Hodgkin lymphoma. Blood. 99(12): 4283-97.
  • TOP