Rat CD302/CLEC13A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:RGB332-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
687bp
Gene Synonym
MGC108799, RGD1307606, Cd302
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat CD302 molecule Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD302/CLEC13A (C-type lectin domain family 13 member A), also known as C-type lectin receptor DCL-1, is a type I transmembrane C-type lectin DCL-1/CD302. DCL-1 protein was highly conserved among the human, mouse, and rat orthologs. DCL-1 ectodomain contains only one CRD, whereas other type I transmembrane C-type lectins contain more than one domain (e.g. selectins and MMR). DCL-1 CP contains several putative motifs, including a Tyr-based internalization, a cluster of acidic amino acids, and Ser and Tyr phosphorylation motifs, suggesting that DCL-1 CP mediates not only endocytosis and late endosome targeting but also signaling. DCL-1 may be another cell/matrix adhesion receptor integrated in cell adhesion complexes and that DCL-1 dysfunction may affect APC adhesion and migration, causing suppression of APC function.
References
  • Kato M, et al. (2007) The novel endocytic and phagocytic C-Type lectin receptor DCL-1/CD302 on macrophages is colocalized with F-actin, suggesting a role in cell adhesion and migration. J Immunol. 179(9): 6052-63.
  • Skinnider BF, et al. (2002) The role of cytokines in classical Hodgkin lymphoma. Blood. 99(12): 4283-97.
  • TOP