Rat CD164 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:RGB287-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
588bp
Gene Synonym
MGC-24v, Cd164
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat CD164 molecule, sialomucin Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Sialomucin core protein 24 also known as endolyn or CD164 (cluster of differentiation 164) is a novel 80- to 90-kD mucin-like molecule expressed by human CD34+ hematopoietic progenitor cells. Isoform 1 and isoform 3 of CD164 are expressed in hematopoietic and non-hematopoietic tissues. Isoform 1 is expressed by prostate cancer tumors and prostate cancer cell lines. The expression is greater in bone metastases than in primary tumors. Expression in osseous metastasis is greater than that in soft tissue metastasis. Isoform 2 of CD164 is expressed in the small intestine, colon, lung, thyroid and in colorectal and pancreatic adenocarcinoma. Isoform 4 is expressed by both hematopoietic progenitor cells and bone marrow stromal cells. CD164 belongs to the CD164 family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. CD164 may play an important role in prostate cancer metastasis and the infiltration of bone marrow by cancer cells. CD164 promotes myogenesis by enhancing CXCR4-dependent cell motility. This protein positively regulates myoblast migration and promotes myoblast fusion into myotubes. CD164 may play a key role in hematopoiesis by facilitating the adhesion of CD34+ cells to bone marrow stroma and by negatively regulating CD34+hematopoietic progenitor cell growth.
References
  • McGuckin CP, et al. (2003) Colocalization analysis of sialomucins CD34 and CD164. Stem Cells. 21(2): 162-70.
  • Doyonnas R, et al. (2000) CD164 monoclonal antibodies that block hemopoietic progenitor cell adhesion and proliferation interact with the first mucin domain of the CD164 receptor. J Immunol. 165(2): 840-51.
  • Zannettino AC, et al. (1998) The sialomucin CD164 (MGC-24v) is an adhesive glycoprotein expressed by human hematopoietic progenitors and bone marrow stromal cells that serves as a potent negative regulator of hematopoiesis. Blood. 92(8): 2613-28.
  • TOP