Rat CD164 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGB287-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
588bp
Gene Synonym
MGC-24v, Cd164
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat CD164 molecule, sialomucin Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Sialomucin core protein 24 also known as endolyn or CD164 (cluster of differentiation 164) is a novel 80- to 90-kD mucin-like molecule expressed by human CD34+ hematopoietic progenitor cells. Isoform 1 and isoform 3 of CD164 are expressed in hematopoietic and non-hematopoietic tissues. Isoform 1 is expressed by prostate cancer tumors and prostate cancer cell lines. The expression is greater in bone metastases than in primary tumors. Expression in osseous metastasis is greater than that in soft tissue metastasis. Isoform 2 of CD164 is expressed in the small intestine, colon, lung, thyroid and in colorectal and pancreatic adenocarcinoma. Isoform 4 is expressed by both hematopoietic progenitor cells and bone marrow stromal cells. CD164 belongs to the CD164 family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. CD164 may play an important role in prostate cancer metastasis and the infiltration of bone marrow by cancer cells. CD164 promotes myogenesis by enhancing CXCR4-dependent cell motility. This protein positively regulates myoblast migration and promotes myoblast fusion into myotubes. CD164 may play a key role in hematopoiesis by facilitating the adhesion of CD34+ cells to bone marrow stroma and by negatively regulating CD34+hematopoietic progenitor cell growth.
References
  • McGuckin CP, et al. (2003) Colocalization analysis of sialomucins CD34 and CD164. Stem Cells. 21(2): 162-70.
  • Doyonnas R, et al. (2000) CD164 monoclonal antibodies that block hemopoietic progenitor cell adhesion and proliferation interact with the first mucin domain of the CD164 receptor. J Immunol. 165(2): 840-51.
  • Zannettino AC, et al. (1998) The sialomucin CD164 (MGC-24v) is an adhesive glycoprotein expressed by human hematopoietic progenitors and bone marrow stromal cells that serves as a potent negative regulator of hematopoiesis. Blood. 92(8): 2613-28.
  • TOP