Rat CD132 / IL2RG Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_080889.1

RefSeq ORF Size

1107bp

Gene Synonym

Cd132, Ab2-183, Il2rg

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 2 receptor, gamma Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The common gamma chain (γc) (or CD132), also known as interleukin-2 receptor subunit gamma or IL2RG, is a member of the type I cytokine receptor family expressed on most lymphocyte (white blood cell) populations, and its gene is found on the X-chromosome of mammals. The common gamma chain (γc) (or IL2RG), is a cytokine receptor sub-unit that is common to the receptor complexes for at least six different interleukin receptors: IL-2, IL-4, IL-7, IL-9, IL-15 and interleukin-21 receptor. It is a component of multiple cytokine receptors that are essential for lymphocyte development and function. X-linked severe combined immunodeficiency (XSCID) is a rare and potentially fatal disease caused by mutations of IL2RG, the gene encoding IL2RG. IL2RG was demonstrated to be a component of the IL-4 receptor on the basis of chemical cross-linking data, the ability of IL2RG to augment IL-4 binding affinity. The observation that IL-2R gamma is a functional component of the IL-4 receptor, together with the finding that IL-2R gamma associates with the IL-7 receptor, begins to elucidate why deficiency of this common gamma chain (gamma c) has a profound effect on lymphoid function and development, as seen in X-linked severe combined immunodeficiency.

References

Russell SM, et al. (1993) Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science. 262 (5141): 1880-3.

Miyazaki T, et al. (1994) Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits. Science. 266 (5187): 1045-7.

Takeshita T, et al. (1992) Cloning of the gamma chain of the human IL-2 receptor. Science. 257 (5068): 379-82.

Catalog Number:RGB268-NY