Rat CD132 / IL2RG Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_080889.1

RefSeq ORF Size

1107bp

Gene Synonym

Cd132, Ab2-183, Il2rg

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 2 receptor, gamma Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The common gamma chain (γc) (or CD132), also known as interleukin-2 receptor subunit gamma or IL2RG, is a member of the type I cytokine receptor family expressed on most lymphocyte (white blood cell) populations, and its gene is found on the X-chromosome of mammals. The common gamma chain (γc) (or IL2RG), is a cytokine receptor sub-unit that is common to the receptor complexes for at least six different interleukin receptors: IL-2, IL-4, IL-7, IL-9, IL-15 and interleukin-21 receptor. It is a component of multiple cytokine receptors that are essential for lymphocyte development and function. X-linked severe combined immunodeficiency (XSCID) is a rare and potentially fatal disease caused by mutations of IL2RG, the gene encoding IL2RG. IL2RG was demonstrated to be a component of the IL-4 receptor on the basis of chemical cross-linking data, the ability of IL2RG to augment IL-4 binding affinity. The observation that IL-2R gamma is a functional component of the IL-4 receptor, together with the finding that IL-2R gamma associates with the IL-7 receptor, begins to elucidate why deficiency of this common gamma chain (gamma c) has a profound effect on lymphoid function and development, as seen in X-linked severe combined immunodeficiency.

References

Russell SM, et al. (1993) Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science. 262 (5141): 1880-3.

Miyazaki T, et al. (1994) Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits. Science. 266 (5187): 1045-7.

Takeshita T, et al. (1992) Cloning of the gamma chain of the human IL-2 receptor. Science. 257 (5068): 379-82.

Catalog Number:RGB268-NM