Rat Cathepsin L/CTSL1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_013156.2

RefSeq ORF Size

1005bp

Gene Synonym

CatL, Ctsl, CATHL

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat cathepsin L1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cathepsin L is a lysosomal cysteine protease that plays a major role in intracellular protein catabolism, and is potent in degrading collagen, laminin, elastin, as well as alpha-1 protease inhibitor and other structural proteins of basement membranes. It is secreted by liver flukes at all stages of their development in the mammalian host, are believed to play important roles in facilitating parasite migration (tissue degradation), feeding and immuno-evasion. Like many proteases, Cathepsin L is synthesized as an inactive preproenzyme, and cleavage of the 96-residue proregion is necessary to generate the fully active 221-residue mature enzyme. Studies have demonstrated that cleavage of the proregion occur autocatalytically under acidic conditions. The enzyme takes part in nutrient acquisition by catabolizing host proteins to absorbable peptides, facilitates the migration of the parasite through the host intestine and liver by cleaving interstitial matrix proteins such as fibronectin, laminin and native collagen and is implicated in the inactivation of host immune defenses by cleaving immunoglobulins. Recently, Cathepsin L has been shown to suppress Th1 immune response in infected laboratory animals making them susceptible to concurrent bacterial infections. Cathepsin L is synthesized in large amounts and secreted by many malignantly transformed cells, and induced by growth factors and tumor promoters. In addition to its role in protein degradation, evidence has accumulated for the participation of Cathepsin L in various physiological and pathological processes, such as tumor invasion and metastasis, bone resorption, spermatogenesis, and arthritis. Accordingly, Cathepsin L may prove useful as a diagnostic or prognostic marker of human tumor malignancy.

References

Mulcahy G, et al. (2001) Cathepsin L proteinases as vaccines against infection with Fasciola hepatica (liver fluke) in ruminants. Res Vet Sci. 70(1): 83-6.

Dixit AK, et al. (2008) Immunodiagnostic/protective role of cathepsin L cysteine proteinases secreted by Fasciola species. Vet Parasitol. 154(3-4): 177-84.

Leto G, et al. (2010) Cathepsin L in metastatic bone disease: therapeutic implications. Biol Chem. 391(6): 655-64.

Catalog Number:RGB144-NF