Rat Cathepsin L/CTSL1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGB144-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1005bp
Gene Synonym
CatL, Ctsl, CATHL
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cathepsin L1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cathepsin L is a lysosomal cysteine protease that plays a major role in intracellular protein catabolism, and is potent in degrading collagen, laminin, elastin, as well as alpha-1 protease inhibitor and other structural proteins of basement membranes. It is secreted by liver flukes at all stages of their development in the mammalian host, are believed to play important roles in facilitating parasite migration (tissue degradation), feeding and immuno-evasion. Like many proteases, Cathepsin L is synthesized as an inactive preproenzyme, and cleavage of the 96-residue proregion is necessary to generate the fully active 221-residue mature enzyme. Studies have demonstrated that cleavage of the proregion occur autocatalytically under acidic conditions. The enzyme takes part in nutrient acquisition by catabolizing host proteins to absorbable peptides, facilitates the migration of the parasite through the host intestine and liver by cleaving interstitial matrix proteins such as fibronectin, laminin and native collagen and is implicated in the inactivation of host immune defenses by cleaving immunoglobulins. Recently, Cathepsin L has been shown to suppress Th1 immune response in infected laboratory animals making them susceptible to concurrent bacterial infections. Cathepsin L is synthesized in large amounts and secreted by many malignantly transformed cells, and induced by growth factors and tumor promoters. In addition to its role in protein degradation, evidence has accumulated for the participation of Cathepsin L in various physiological and pathological processes, such as tumor invasion and metastasis, bone resorption, spermatogenesis, and arthritis. Accordingly, Cathepsin L may prove useful as a diagnostic or prognostic marker of human tumor malignancy.
References
  • Mulcahy G, et al. (2001) Cathepsin L proteinases as vaccines against infection with Fasciola hepatica (liver fluke) in ruminants. Res Vet Sci. 70(1): 83-6.
  • Dixit AK, et al. (2008) Immunodiagnostic/protective role of cathepsin L cysteine proteinases secreted by Fasciola species. Vet Parasitol. 154(3-4): 177-84.
  • Leto G, et al. (2010) Cathepsin L in metastatic bone disease: therapeutic implications. Biol Chem. 391(6): 655-64.
  • TOP