Rat Caspase-14/CASP14 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:RGB131-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
741bp
Gene Synonym
caspase-14
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat caspase 14 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Caspase 14 is a member of the caspase family. Caspases are a kind of cysteine proteinase consisting of a prodomain plus large and small catalytic subunits, that play a central role in cell apoptosis. Caspase 14 possesses an unusually short prodomain and is highly expressed in embryonic tissues but absent from most of the adult tissues except for the skin, which suggests a role in ontogenesis and skin physiology. Unlike the other short prodomain caspases(caspase-3, caspase-6, and caspase-7), Caspase 14 was not processed by multiple death stimuli including activation of members of the tumor necrosis factor receptor family and expression of proapaptotic members of the bcl-2 family. Caspase 14 has been described to be processed and activated by anti-Fas agonist antibody or TNF-related apoptosis inducing ligand in vivo. The expression and processing of this caspase may take part in keratinocyte terminal differentiation, which is essential for the skin barrier.
References
  • Hu SM, et al. (1998) Caspase-14 is a novel developmentally regulated protease. The journal of biological chemistry. 273: 29648-53.
  • Marc Van De Craen, et al. (1998) Identification of a new caspase homologue: caspase-14. Cell death differ. 5(10): 838-46.
  • TOP