Rat Caspase-14/CASP14 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGB131-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
741bp
Gene Synonym
caspase-14
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat caspase 14 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Caspase 14 is a member of the caspase family. Caspases are a kind of cysteine proteinase consisting of a prodomain plus large and small catalytic subunits, that play a central role in cell apoptosis. Caspase 14 possesses an unusually short prodomain and is highly expressed in embryonic tissues but absent from most of the adult tissues except for the skin, which suggests a role in ontogenesis and skin physiology. Unlike the other short prodomain caspases(caspase-3, caspase-6, and caspase-7), Caspase 14 was not processed by multiple death stimuli including activation of members of the tumor necrosis factor receptor family and expression of proapaptotic members of the bcl-2 family. Caspase 14 has been described to be processed and activated by anti-Fas agonist antibody or TNF-related apoptosis inducing ligand in vivo. The expression and processing of this caspase may take part in keratinocyte terminal differentiation, which is essential for the skin barrier.
References
  • Hu SM, et al. (1998) Caspase-14 is a novel developmentally regulated protease. The journal of biological chemistry. 273: 29648-53.
  • Marc Van De Craen, et al. (1998) Identification of a new caspase homologue: caspase-14. Cell death differ. 5(10): 838-46.
  • TOP