Rat Cadherin-8 / CDH8 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:RGB040-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2400bp
Gene Synonym
Cdh8
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cadherin 8 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cadherins are integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Type I cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of five subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I  cadherins. Cadherin 8, also known as CDH 8, is a type I I classical cadherin belonging to the cadherin superfamily. As mainly expressed in brain, CDH8 is found in certain nerve cell lines, such as retinoblasts, glioma cells and neuroblasts, and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Human Cadherin 8 is a 799 amino acid single-pass type I  transmembrane protein with a putative 29 aa signal sequence, and a 32 aa propeptide, a 560 aa mature extracellular domain, a 21 aa transmembrane domain and a 157 aa cytoplasmic domain. The human, mouse and rat proteins share approximately 98% homology.
References
  • Tanihara, H. et al., 1994, Cell Adhes. Comm. 2:15-26.
  • Kido, M. et al., 1998, Genomics 48:186-194.
  • Yamagata, K. et al., 1999, J. Biol. Chem. 274:19473-19479.
  • Nollet, F. et al., 2000, J. Mol. Biol. 299:551-572.
  • Blaschke, S. et al., 2002, Int. J. Cancer. 101 (4): 327-334.
  • Strausberg,R.L. et al., 2003, Proc. Natl. Acad. Sci. U.S.A. 99 (26): 16899–16903.
  • TOP