Rat Cadherin-8 / CDH8 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:RGB040-CG

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2400bp
Gene Synonym
Cdh8
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cadherin 8 Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cadherins are integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Type I cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of five subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I  cadherins. Cadherin 8, also known as CDH 8, is a type I I classical cadherin belonging to the cadherin superfamily. As mainly expressed in brain, CDH8 is found in certain nerve cell lines, such as retinoblasts, glioma cells and neuroblasts, and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Human Cadherin 8 is a 799 amino acid single-pass type I  transmembrane protein with a putative 29 aa signal sequence, and a 32 aa propeptide, a 560 aa mature extracellular domain, a 21 aa transmembrane domain and a 157 aa cytoplasmic domain. The human, mouse and rat proteins share approximately 98% homology.
References
  • Tanihara, H. et al., 1994, Cell Adhes. Comm. 2:15-26.
  • Kido, M. et al., 1998, Genomics 48:186-194.
  • Yamagata, K. et al., 1999, J. Biol. Chem. 274:19473-19479.
  • Nollet, F. et al., 2000, J. Mol. Biol. 299:551-572.
  • Blaschke, S. et al., 2002, Int. J. Cancer. 101 (4): 327-334.
  • Strausberg,R.L. et al., 2003, Proc. Natl. Acad. Sci. U.S.A. 99 (26): 16899–16903.
  • TOP