Rat Apolipoprotein A-I/ApoA1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_012738.1

RefSeq ORF Size

780bp

Gene Synonym

apoA-I

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat apolipoprotein A-I Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Apolipoprotein A1 (APOA1) is a member of the apolipoprotein family whose members are proteins bind with lipids and form lipoproteins to translate these oil-soluble lipids such as fat and cholesterol through lymphatic and circulatory system. APOA1 is the main component of high density lipoprotein (HDL) in plasma and is involved in the esterification of cholesterol as a cofactor of lecithin-cholesterol acyltransferase (LCAT) which is responsible for the formation of most plasma cholesteryl esters, and thus play a major role in cholesterol efflux from peripheral cells. As a major component of the HDL complex, APOA1 helps to clear cholesterol from arteries. APOA1 is also characterized as a prostacyclin stabilizing factor, and thus may have an anticlotting effect. Defects in encoding gene may result in HDL deficiencies, including Tangier disease, and with systemic non-neuropathic amyloidosis. Men carrying a mutation may develop premature coronary artery disease.

References

Toptas B, et al. (2011) Comparison of lipid profiles with APOA1 MspI polymorphism in obese children with hyperlipidemia. In Vivo. 25(3): 425-30.

Haase CL, et al. (2011) Mutation in APOA1 predicts increased risk of ischaemic heart disease and total mortality without low HDL cholesterol levels. J Intern Med. 270(2): 136-46.

Wu Z, et al. (2011) The low resolution structure of ApoA1 in spherical high density lipoprotein revealed small angle neutron scattering. J Biol Chem. 286(14): 12495-508.

Catalog Number:RGA486-NY