Rat Apolipoprotein A-I/ApoA1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_012738.1

RefSeq ORF Size

780bp

Gene Synonym

apoA-I

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat apolipoprotein A-I Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Apolipoprotein A1 (APOA1) is a member of the apolipoprotein family whose members are proteins bind with lipids and form lipoproteins to translate these oil-soluble lipids such as fat and cholesterol through lymphatic and circulatory system. APOA1 is the main component of high density lipoprotein (HDL) in plasma and is involved in the esterification of cholesterol as a cofactor of lecithin-cholesterol acyltransferase (LCAT) which is responsible for the formation of most plasma cholesteryl esters, and thus play a major role in cholesterol efflux from peripheral cells. As a major component of the HDL complex, APOA1 helps to clear cholesterol from arteries. APOA1 is also characterized as a prostacyclin stabilizing factor, and thus may have an anticlotting effect. Defects in encoding gene may result in HDL deficiencies, including Tangier disease, and with systemic non-neuropathic amyloidosis. Men carrying a mutation may develop premature coronary artery disease.

References

Toptas B, et al. (2011) Comparison of lipid profiles with APOA1 MspI polymorphism in obese children with hyperlipidemia. In Vivo. 25(3): 425-30.

Haase CL, et al. (2011) Mutation in APOA1 predicts increased risk of ischaemic heart disease and total mortality without low HDL cholesterol levels. J Intern Med. 270(2): 136-46.

Wu Z, et al. (2011) The low resolution structure of ApoA1 in spherical high density lipoprotein revealed small angle neutron scattering. J Biol Chem. 286(14): 12495-508.

Catalog Number:RGA486-CF