Rat ADSL / Adenylosuccinate Lyase Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGA226-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1455bp
Gene Synonym
null
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat adenylosuccinate lyase Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Adenylosuccinate lyase, also known as adenylosuccinase, ADSL or ASL, is an enzyme implicated in the reaction of adenylosuccinat converting to AMP and fumarate as part of the purine nucleotide cycle. The two substates of adenylosuccinate lyase (ADSL) are dephosphorylated derivatives of SAICA ribotide (SAICAR) and adenylosuccinate (S-AMP), which catalyzes an important reaction in the de novo pathway of purine biosynthesis. ADSL catalyzes two distinct reactions in the synthesis of purine nucleotides, both of which involve the _-elimination of fumarate to produce either aminoimidazole carboxamide ribotide from SAICAR or AMP from S-AMP. The Adenylosuccinate lyase deficiency is a rare autosomal recessive metabolic disorder characterized by the present of SAICA riboside and succinyladenosine (S-Ado). ADSL defect in different patients is often caused by different mutations to the enzyme.
References
  • Nassogne M, et al. (2000) Adenylosuccinase deficiency: an unusual cause of early-onset epilepsy associated with acquired microcephaly. Brain and development. 22 (6): 383-6.
  • Sivendran S, et al. (2004) Two novel mutant human adenylosuccinate lyases (ASLs) associated with autism and characterization of the equivalent mutant Bacillus subtilis ASL. J Biol Chem. 279 (51): 53789-97.
  • Lee TT, et al. (1999) His68 and His141 are critical contributors to the intersubunit catalytic site of adenylosuccinate lyase of Bacillus subtilis. Biochemistry. 38 (1): 22-32.
  • TOP