Rat ADSL / Adenylosuccinate Lyase Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:RGA226-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1455bp
Gene Synonym
null
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat adenylosuccinate lyase Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Adenylosuccinate lyase, also known as adenylosuccinase, ADSL or ASL, is an enzyme implicated in the reaction of adenylosuccinat converting to AMP and fumarate as part of the purine nucleotide cycle. The two substates of adenylosuccinate lyase (ADSL) are dephosphorylated derivatives of SAICA ribotide (SAICAR) and adenylosuccinate (S-AMP), which catalyzes an important reaction in the de novo pathway of purine biosynthesis. ADSL catalyzes two distinct reactions in the synthesis of purine nucleotides, both of which involve the _-elimination of fumarate to produce either aminoimidazole carboxamide ribotide from SAICAR or AMP from S-AMP. The Adenylosuccinate lyase deficiency is a rare autosomal recessive metabolic disorder characterized by the present of SAICA riboside and succinyladenosine (S-Ado). ADSL defect in different patients is often caused by different mutations to the enzyme.
References
  • Nassogne M, et al. (2000) Adenylosuccinase deficiency: an unusual cause of early-onset epilepsy associated with acquired microcephaly. Brain and development. 22 (6): 383-6.
  • Sivendran S, et al. (2004) Two novel mutant human adenylosuccinate lyases (ASLs) associated with autism and characterization of the equivalent mutant Bacillus subtilis ASL. J Biol Chem. 279 (51): 53789-97.
  • Lee TT, et al. (1999) His68 and His141 are critical contributors to the intersubunit catalytic site of adenylosuccinate lyase of Bacillus subtilis. Biochemistry. 38 (1): 22-32.
  • TOP