Mouse VDR-NR111 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGI339-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1269bp
Gene Synonym
Nr1i1, Vdr
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse vitamin D receptor Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
VDR (vitamin D(1,25- dihydroxyvitamin D3)receptor), also known as NR1I1, belongs to the NR1I family, NR1 subfamily. It is composed of three domains: a modulating N-terminal domain, a DNA-binding domain and a C-terminal ligand-binding domain. Vitamin D receptors (VDRs) are members of the NR1I family, which also includes pregnane X (PXR) and constitutive androstane (CAR) receptors, that form heterodimers with members of the retinoid X receptor family. VDRs repress expression of 1alpha-hydroxylase (the proximal activator of 1,25(OH)2D3) and induce expression of the 1,25(OH)2D3 inactivating enzyme CYP24. Also, it has recently been identified as an additional bile acid receptor alongside FXR and may function to protect gut against the toxic and carcinogenic effects of these endobiotics. VDR is expressed in the intestine, thyroid and kidney and has a vital role in calcium homeostasis. It is the nuclear hormone receptor, also called transcription factor that mediates the action of vitamin D3. Inherited mutations in the VDR gene leads to rickets.
References
  • Moore DD, et al. (2006) The NR1H and NR1I receptors: constitutive androstane receptor, pregnene X receptor, farnesoid X receptor alpha, farnesoid X receptor beta, liver X receptor alpha, liver X receptor beta, and vitamin D receptor. Pharmacol Rev. 58(4):742-59.
  • Szpirer J, et al. (1991)The Sp1 transcription factor gene (SP1) and the 1,25-dihydroxyvitamin D3 receptor gene (VDR) are colocalized on human chromosome arm 12q and rat chromosome 7. Genomics. 11(1):168-73.
  • Germain P, et al. (2006) Overview of nomenclature of nuclear receptors. Pharmacol Rev. 58(4): 685-704.
  • Adorini L, et al. (2006) Vitamin D receptor agonists, cancer and the immune system: an intricate relationship. Curr Top Med Chem. 6(12):1297-301.
  • Luderer HF, et al. (2010) The vitamin D receptor, the skin and stem cells. J Steroid Biochem Mol Biol. 121(1-2):314-6.
  • TOP