Mouse VDR-NR111 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009504.4

RefSeq ORF Size

1269bp

Gene Synonym

Nr1i1, Vdr

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse vitamin D receptor Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

VDR (vitamin D(1,25- dihydroxyvitamin D3)receptor), also known as NR1I1, belongs to the NR1I family, NR1 subfamily. It is composed of three domains: a modulating N-terminal domain, a DNA-binding domain and a C-terminal ligand-binding domain. Vitamin D receptors (VDRs) are members of the NR1I family, which also includes pregnane X (PXR) and constitutive androstane (CAR) receptors, that form heterodimers with members of the retinoid X receptor family. VDRs repress expression of 1alpha-hydroxylase (the proximal activator of 1,25(OH)2D3) and induce expression of the 1,25(OH)2D3 inactivating enzyme CYP24. Also, it has recently been identified as an additional bile acid receptor alongside FXR and may function to protect gut against the toxic and carcinogenic effects of these endobiotics. VDR is expressed in the intestine, thyroid and kidney and has a vital role in calcium homeostasis. It is the nuclear hormone receptor, also called transcription factor that mediates the action of vitamin D3. Inherited mutations in the VDR gene leads to rickets.

References

Moore DD, et al. (2006) The NR1H and NR1I receptors: constitutive androstane receptor, pregnene X receptor, farnesoid X receptor alpha, farnesoid X receptor beta, liver X receptor alpha, liver X receptor beta, and vitamin D receptor. Pharmacol Rev. 58(4):742-59.

Szpirer J, et al. (1991)The Sp1 transcription factor gene (SP1) and the 1,25-dihydroxyvitamin D3 receptor gene (VDR) are colocalized on human chromosome arm 12q and rat chromosome 7. Genomics. 11(1):168-73.

Germain P, et al. (2006) Overview of nomenclature of nuclear receptors. Pharmacol Rev. 58(4): 685-704.

Adorini L, et al. (2006) Vitamin D receptor agonists, cancer and the immune system: an intricate relationship. Curr Top Med Chem. 6(12):1297-301.

Luderer HF, et al. (2010) The vitamin D receptor, the skin and stem cells. J Steroid Biochem Mol Biol. 121(1-2):314-6.

Catalog Number:MGI339-CF