Mouse TRIB3/TRB3 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGI032-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1065bp
Gene Synonym
Nipk, SINK, Trb3, Ifld2, SKIP3, TRB-3, Trib3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse tribbles homolog 3 (Drosophila) Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tribbles homolog 3, also known as Neuronal cell death-inducible putative kinase, p65-interacting inhibitor of NF-kappa-B, SINK and TRIB3, is a Nucleus protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family and Tribbles subfamily. Highest expression Of TRIB3 is in liver, pancreas, peripheral blood leukocytes and bone marrow. It is also highly expressed in a number of primary lung, colon and breast tumors. TRIB3 is expressed in spleen, thymus, and prostate and is undetectable in other examined tissues, including testis, ovary, small intestine, colon, leukocyte, heart, brain, placenta, lung, skeletal muscle, and kidney. TRIB3 disrupts insulin signaling by binding directly to Akt kinases and blocking their activation. TRIB3 may bind directly to and mask the 'Thr-308' phosphorylation site in AKT1. It binds to ATF4 and inhibits its transcriptional activation activity. TRIB3 interacts with the NF-kappa-B transactivator p65 RELA and inhibits its phosphorylation and thus its transcriptional activation activity. It interacts with MAPK kinases and regulates activation of MAP kinases. It may play a role in programmed neuronal cell death but does not appear to affect non-neuronal cells. TRIB3 does not display kinase activity.
References
  • Wu M. et al., 2003, J. Biol. Chem. 278: 27072-9.
  • Kiss-Toth E. et al., 2004, J. Biol. Chem. 279: 42703-8.
  • Ord D., et al.,2005, Biochem. Biophys. Res. Commun. 330: 210-8.
  • Schwarzer R. et al., 2006, Cell. Signal. 18:899-909.
  • Greenman C. et al., 2007, Nature. 446:153-8.
  • TOP