Mouse TRIB3/TRB3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGI032-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1065bp
Gene Synonym
Nipk, SINK, Trb3, Ifld2, SKIP3, TRB-3, Trib3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse tribbles homolog 3 (Drosophila) Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tribbles homolog 3, also known as Neuronal cell death-inducible putative kinase, p65-interacting inhibitor of NF-kappa-B, SINK and TRIB3, is a Nucleus protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family and Tribbles subfamily. Highest expression Of TRIB3 is in liver, pancreas, peripheral blood leukocytes and bone marrow. It is also highly expressed in a number of primary lung, colon and breast tumors. TRIB3 is expressed in spleen, thymus, and prostate and is undetectable in other examined tissues, including testis, ovary, small intestine, colon, leukocyte, heart, brain, placenta, lung, skeletal muscle, and kidney. TRIB3 disrupts insulin signaling by binding directly to Akt kinases and blocking their activation. TRIB3 may bind directly to and mask the 'Thr-308' phosphorylation site in AKT1. It binds to ATF4 and inhibits its transcriptional activation activity. TRIB3 interacts with the NF-kappa-B transactivator p65 RELA and inhibits its phosphorylation and thus its transcriptional activation activity. It interacts with MAPK kinases and regulates activation of MAP kinases. It may play a role in programmed neuronal cell death but does not appear to affect non-neuronal cells. TRIB3 does not display kinase activity.
References
  • Wu M. et al., 2003, J. Biol. Chem. 278: 27072-9.
  • Kiss-Toth E. et al., 2004, J. Biol. Chem. 279: 42703-8.
  • Ord D., et al.,2005, Biochem. Biophys. Res. Commun. 330: 210-8.
  • Schwarzer R. et al., 2006, Cell. Signal. 18:899-909.
  • Greenman C. et al., 2007, Nature. 446:153-8.
  • TOP