Mouse TRIB2 / TRB2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_144551.5

RefSeq ORF Size

1032bp

Gene Synonym

TRB2, TRB-2, AW319517, Trib2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse tribbles homolog 2 (Drosophila) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tribbles homolog 2, also known as TRB-2, and Trib2, is a member of the protein kinase superfamily and Tribbles subfamily (Trib1, Trib2, Trib3). The identification of tribbles as regulators of signal processing systems and physiological processes, including development, together with their potential involvement in diabetes and cancer, has generated considerable interest in these proteins. Tribbles have been reported to regulate activation of a number of intracellular signalling pathways with roles extending from mitosis and cell activation to apoptosis and modulation of gene expression. Tribbles controls the timing of mitosis in the prospective mesoderm, allowing cell-shape changes to be completed. This mechanism for coordinating cell division and cell-shape changes may have helped Drosophila to evolve its mode of rapid early development. Trib2 was identified as a downregulated transcript in leukemic cells undergoing growth arrest. Trib2-transduced bone marrow cells exhibited a growth advantage and readily established factor-dependent cell lines. Trib2-reconstituted mice uniformly developed fatal transplantable acute myelogenous leukemia (AML).

References

Seher, TC. et al., 2000, Curr Biol. 10 (11): 623-9.

Keeshan, K. et al., 2006, Cancer Cell. 10 (5): 401-11.

Hegedus, Z. et al., 2007, Cell Signal. 19 (2):238-50.

Keeshan, K. et al., 2008, Blood Cells Mol Dis. 40 (1): 119-21.

Cvetkovic, LV. et al., 2010, J Clin Invest. 120 (3): 713-9.

Catalog Number:MGI031-CY