Mouse TRIB2 / TRB2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGI031-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1032bp
Gene Synonym
TRB2, TRB-2, AW319517, Trib2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse tribbles homolog 2 (Drosophila) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tribbles homolog 2, also known as TRB-2, and Trib2, is a member of the protein kinase superfamily and Tribbles subfamily (Trib1, Trib2, Trib3). The identification of tribbles as regulators of signal processing systems and physiological processes, including development, together with their potential involvement in diabetes and cancer, has generated considerable interest in these proteins. Tribbles have been reported to regulate activation of a number of intracellular signalling pathways with roles extending from mitosis and cell activation to apoptosis and modulation of gene expression. Tribbles controls the timing of mitosis in the prospective mesoderm, allowing cell-shape changes to be completed. This mechanism for coordinating cell division and cell-shape changes may have helped Drosophila to evolve its mode of rapid early development. Trib2 was identified as a downregulated transcript in leukemic cells undergoing growth arrest. Trib2-transduced bone marrow cells exhibited a growth advantage and readily established factor-dependent cell lines. Trib2-reconstituted mice uniformly developed fatal transplantable acute myelogenous leukemia (AML).
References
  • Seher, TC. et al., 2000, Curr Biol. 10 (11): 623-9.
  • Keeshan, K. et al., 2006, Cancer Cell. 10 (5): 401-11.
  • Hegedus, Z. et al., 2007, Cell Signal. 19 (2):238-50.
  • Keeshan, K. et al., 2008, Blood Cells Mol Dis. 40 (1): 119-21.
  • Cvetkovic, LV. et al., 2010, J Clin Invest. 120 (3): 713-9.
  • TOP