Mouse Thioredoxin/TXN/SASP Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGH704-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
318bp
Gene Synonym
ADF, Txn, Trx1, AW550880, Txn1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse thioredoxin 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Thioredoxin, also known as ATL-derived factor, Surface-associated sulphydryl protein, SASP and TXN, is a nucleus, cytoplasm and secreted protein which belongs to the thioredoxin family. Thioredoxins are proteins that act as antioxidants by facilitating the reduction of other proteins by cysteine thiol-disulfide exchange. Thioredoxins are found in nearly all known organisms and are essential for life in mammals. Thioredoxin / TXN participates in various redox reactions through the reversible oxidation of its active center dithiol to a disulfide and catalyzes dithiol-disulfide exchange reactions. Thioredoxin / TXN plays a role in the reversible S-nitrosylation of cysteine residues in target proteins, and thereby contributes to the response to intracellular nitric oxide. Thioredoxin / TXN nitrosylates the active site Cys of CASP3 in response to nitric oxide (NO), and thereby inhibits caspase-3 activity. Thioredoxin / TXN induces the FOS/JUN AP-1 DNA-binding activity in ionizing radiation (IR) cells through its oxidation/reduction status and stimulates AP-1 transcriptional activity.
References
  • Holmgren A , et al.,1989, J Biol Chem 264 (24): 13963-6.
  • Nordberg J, et al., 2001, Free Radic Biol Med31 (11): 1287-312.
  • Mustacich D, et al., 2000, Biochem J 346 (Pt 1): 1-8. 
  • Mitchell D.A., et al., 2005, Nat. Chem. Biol. 1:154-158.
  • TOP