Mouse Thioredoxin/TXN/SASP Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011660.3

RefSeq ORF Size

318bp

Gene Synonym

ADF, Txn, Trx1, AW550880, Txn1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse thioredoxin 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Thioredoxin, also known as ATL-derived factor, Surface-associated sulphydryl protein, SASP and TXN, is a nucleus, cytoplasm and secreted protein which belongs to the thioredoxin family. Thioredoxins are proteins that act as antioxidants by facilitating the reduction of other proteins by cysteine thiol-disulfide exchange. Thioredoxins are found in nearly all known organisms and are essential for life in mammals. Thioredoxin / TXN participates in various redox reactions through the reversible oxidation of its active center dithiol to a disulfide and catalyzes dithiol-disulfide exchange reactions. Thioredoxin / TXN plays a role in the reversible S-nitrosylation of cysteine residues in target proteins, and thereby contributes to the response to intracellular nitric oxide. Thioredoxin / TXN nitrosylates the active site Cys of CASP3 in response to nitric oxide (NO), and thereby inhibits caspase-3 activity. Thioredoxin / TXN induces the FOS/JUN AP-1 DNA-binding activity in ionizing radiation (IR) cells through its oxidation/reduction status and stimulates AP-1 transcriptional activity.

References

Holmgren A , et al.,1989, J Biol Chem 264 (24): 13963-6.

Nordberg J, et al., 2001, Free Radic Biol Med31 (11): 1287-312.

Mustacich D, et al., 2000, Biochem J 346 (Pt 1): 1-8.

Mitchell D.A., et al., 2005, Nat. Chem. Biol. 1:154-158.

Catalog Number:MGH704-CY