Rat TGM2 / Transglutaminase 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGH691-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2061bp
Gene Synonym
TgaseII
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat transglutaminase 2, C polypeptide Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Protein-glutamine gamma-glutamyltransferase 2, also known as Tissue transglutaminase, Transglutaminase C, Transglutaminase-2, and TGM2, is a member of the transglutaminase superfamily. TGM2 plays a role in cell growth and survival through the anti-apoptosis signaling pathway. It is a calcium-dependent acyltransferase which also undergoes a GTP-binding/GTPase cycle even though it lacks any obvious sequence similarity with canonical GTP-binding (G) proteins. TGM2 is a multi-functional protein which catalyzes transamidation reactions or acts as a G-protein in intracellular signalling. As an enzyme which is responsible for the majority of transglutaminase (TG) activity in the brain, TGM2 is likely to play a modulatory role in nervous system development and has regulatory effect on neuronal cell death as well. Most importantly, numerous studies have presented data demonstrating that dysregulation of TGM2 may contribute to the pathogenesis of many neurodegenerative disorders, including Huntington's disease, Alzheimer's disease, Parkinson's disease and amyotrophic lateral sclerosis as well as nervous system injuries.
References
  • Ruan Q, et al. (2007) Transglutaminase 2 in neurodegenerative disorders. Front Biosci. 12: 891-904.
  • Ai L, et al. (2008) The transglutaminase 2 gene (TGM2), a potential molecular marker for chemotherapeutic drug sensitivity, is epigenetically silenced in breast cancer. Carcinogenesis. 29(3): 510-8.
  • Filiano AJ, et al. (2010) Transglutaminase 2 protects against ischemic stroke. Neurobiol Dis. 39(3): 334-43.
  • Park D, et al. (2010) Transglutaminase 2: a multi-functional protein in multiple subcellular compartments. Amino Acids. 39(3): 619-31.
  • Miyoshi N, et al. (2010) TGM2 is a novel marker for prognosis and therapeutic target in colorectal cancer. Ann Surg Oncol. 17(4): 967-72.
  • TOP