Rat TGM2 / Transglutaminase 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_019386.2

RefSeq ORF Size

2061bp

Gene Synonym

TgaseII

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat transglutaminase 2, C polypeptide Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Protein-glutamine gamma-glutamyltransferase 2, also known as Tissue transglutaminase, Transglutaminase C, Transglutaminase-2, and TGM2, is a member of the transglutaminase superfamily. TGM2 plays a role in cell growth and survival through the anti-apoptosis signaling pathway. It is a calcium-dependent acyltransferase which also undergoes a GTP-binding/GTPase cycle even though it lacks any obvious sequence similarity with canonical GTP-binding (G) proteins. TGM2 is a multi-functional protein which catalyzes transamidation reactions or acts as a G-protein in intracellular signalling. As an enzyme which is responsible for the majority of transglutaminase (TG) activity in the brain, TGM2 is likely to play a modulatory role in nervous system development and has regulatory effect on neuronal cell death as well. Most importantly, numerous studies have presented data demonstrating that dysregulation of TGM2 may contribute to the pathogenesis of many neurodegenerative disorders, including Huntington's disease, Alzheimer's disease, Parkinson's disease and amyotrophic lateral sclerosis as well as nervous system injuries.

References

Ruan Q, et al. (2007) Transglutaminase 2 in neurodegenerative disorders. Front Biosci. 12: 891-904.

Ai L, et al. (2008) The transglutaminase 2 gene (TGM2), a potential molecular marker for chemotherapeutic drug sensitivity, is epigenetically silenced in breast cancer. Carcinogenesis. 29(3): 510-8.

Filiano AJ, et al. (2010) Transglutaminase 2 protects against ischemic stroke. Neurobiol Dis. 39(3): 334-43.

Park D, et al. (2010) Transglutaminase 2: a multi-functional protein in multiple subcellular compartments. Amino Acids. 39(3): 619-31.

Miyoshi N, et al. (2010) TGM2 is a novel marker for prognosis and therapeutic target in colorectal cancer. Ann Surg Oncol. 17(4): 967-72.

Catalog Number:MGH691-CO