Mouse TGFBR3 / Betaglycan Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:MGH686-NH

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2553bp
Gene Synonym
TBRIII, AU015626, AW215636, 1110036H20Rik, Tgfbr3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse transforming growth factor, beta receptor III Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Betaglycan also known as transforming growth factor beta receptor III (TGFBR3), is a cell-surface chondroitin sulfate / heparan sulfate proteoglycan. TGFBR3 is a transforming growth factor (TGF)-beta type III receptor. This receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. TGFBR3 is the TGF-β component most commonly downregulated among localized human prostate cancer studies. TGFBR3 knockdown led to focus formation and enhanced expression of CD133, a marker found on prostate cancer stem cells. TGFBR3 is an accessory receptor that binds to and modulates the activities of both transforming growth factor-beta (TGFβ) and inhibin, two members of the TGFβ superfamily of growth factors that regulate many aspects of reproductive biology. TGFBR3 is known to be expressed in adult testis and ovary, but little is known about this receptor during gonadogenesis.
References
  • Johnson DW, et al. (1996) Assignment of human transforming growth factor-beta type I and type III receptor genes (TGFBR1 and TGFBR3) to 9q33-q34 and 1p32-p33, respectively. Genomics. 28 (2): 356-7.
  • Rotzer D, et al. (2001) Type III TGF-beta receptor-independent signalling of TGF-beta2 via T betaRII-B, an alternatively spliced TGF- type II receptor. EMBO J. 20 (3): 480-90.
  • Gao J, et al. (1999) Expression of transforming growth factor-beta receptors types II and III within various cells in the rat periodontium. J Periodont Res. 34 (2): 113-22.
  • TOP