Mouse TGFBR3 / Betaglycan Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011578.2

RefSeq ORF Size

2553bp

Gene Synonym

TBRIII, AU015626, AW215636, 1110036H20Rik, Tgfbr3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse transforming growth factor, beta receptor III Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Betaglycan also known as transforming growth factor beta receptor III (TGFBR3), is a cell-surface chondroitin sulfate / heparan sulfate proteoglycan. TGFBR3 is a transforming growth factor (TGF)-beta type III receptor. This receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. TGFBR3 is the TGF-β component most commonly downregulated among localized human prostate cancer studies. TGFBR3 knockdown led to focus formation and enhanced expression of CD133, a marker found on prostate cancer stem cells. TGFBR3 is an accessory receptor that binds to and modulates the activities of both transforming growth factor-beta (TGFβ) and inhibin, two members of the TGFβ superfamily of growth factors that regulate many aspects of reproductive biology. TGFBR3 is known to be expressed in adult testis and ovary, but little is known about this receptor during gonadogenesis.

References

Johnson DW, et al. (1996) Assignment of human transforming growth factor-beta type I and type III receptor genes (TGFBR1 and TGFBR3) to 9q33-q34 and 1p32-p33, respectively. Genomics. 28 (2): 356-7.

Rotzer D, et al. (2001) Type III TGF-beta receptor-independent signalling of TGF-beta2 via T betaRII-B, an alternatively spliced TGF- type II receptor. EMBO J. 20 (3): 480-90.

Gao J, et al. (1999) Expression of transforming growth factor-beta receptors types II and III within various cells in the rat periodontium. J Periodont Res. 34 (2): 113-22.

Catalog Number:MGH686-CY