Mouse SynCam/CADM1/TSLC1/IGSF4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

RefSeq ORF Size

1338bp

Gene Synonym

Bl2, ST17, Igsf4, Necl2, RA175, Tslc1, Igsf4a, RA175A, RA175B, RA175C, RA175N, SgIGSF, SynCam, AI987920, 2900073G06Rik, 3100001I08Rik, Cadm1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse cell adhesion molecule 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Members of the immunoglobulin superfamily often play key roles in intercellular adhesion. IGSF4 is a novel immunoglobulin (Ig)-like intercellular adhesion molecule. Three Ig-like domains are included in the extracellular domain of IGSF4 and mediate homophilic or heterophilic interactions independently of Ca2+. The cytoplasmic domain of IGSF4 contains the binding motifs that connect to actin fibers. Since IGSF4 has been characterized by several independent research groups, this molecule is called by three names, TSLC1, SgIGSF and SynCAM. IGSF4 was first characterized as a tumor suppressor of non-small cell lung cancer and termed TSLC1. It is a single-pass type I membrane protein which belongs to the nectin family, which may be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. In addition, CADM1 may play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa. In neuroblastoma, loss of CADM1 expression has recently been found in disseminated tumours with adverse outcome, prompting us to investigate its role in neuroblastoma tumour progression. The downregulation of CADM1 tumour suppressor gene expression is a critical event in neuroblastoma pathogenesis resulting in tumour progression.

References

Watabe K, et al. (2003) IGSF4: a new intercellular adhesion molecule that is called by three names, TSLC1, SgIGSF and SynCAM, by virtue of its diverse function. Histol Histopathol. 18(4): 1321-9.

Fujita E, et al. (2005) Distribution of RA175/TSLC1/SynCAM, a member of the immunoglobulin superfamily, in the developing nervous system. Brain Res Dev Brain Res. 154(2): 199-209.

Fujita E, et al. (2006) Oligo-astheno-teratozoospermia in mice lacking RA175/TSLC1/SynCAM/IGSF4A, a cell adhesion molecule in the immunoglobulin superfamily. Mol Cell Biol. 26(2): 718-26.

Nowacki S, et al. (2008) Expression of the tumour suppressor gene CADM1 is associated with favourable outcome and inhibits cell survival in neuroblastoma. Oncogene. 27(23): 3329-38.

Catalog Number:MGH550-NO