Mouse SynCam/CADM1/TSLC1/IGSF4 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGH550-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1338bp
Gene Synonym
Bl2, ST17, Igsf4, Necl2, RA175, Tslc1, Igsf4a, RA175A, RA175B, RA175C, RA175N, SgIGSF, SynCam, AI987920, 2900073G06Rik, 3100001I08Rik, Cadm1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse cell adhesion molecule 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Members of the immunoglobulin superfamily often play key roles in intercellular adhesion. IGSF4 is a novel immunoglobulin (Ig)-like intercellular adhesion molecule. Three Ig-like domains are included in the extracellular domain of IGSF4 and mediate homophilic or heterophilic interactions independently of Ca2+. The cytoplasmic domain of IGSF4 contains the binding motifs that connect to actin fibers. Since IGSF4 has been characterized by several independent research groups, this molecule is called by three names, TSLC1, SgIGSF and SynCAM. IGSF4 was first characterized as a tumor suppressor of non-small cell lung cancer and termed TSLC1. It is a single-pass type I membrane protein which belongs to the nectin family, which may be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. In addition, CADM1 may play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa. In neuroblastoma, loss of CADM1 expression has recently been found in disseminated tumours with adverse outcome, prompting us to investigate its role in neuroblastoma tumour progression. The downregulation of CADM1 tumour suppressor gene expression is a critical event in neuroblastoma pathogenesis resulting in tumour progression.
References
  • Watabe K, et al. (2003) IGSF4: a new intercellular adhesion molecule that is called by three names, TSLC1, SgIGSF and SynCAM, by virtue of its diverse function. Histol Histopathol. 18(4): 1321-9.
  • Fujita E, et al. (2005) Distribution of RA175/TSLC1/SynCAM, a member of the immunoglobulin superfamily, in the developing nervous system. Brain Res Dev Brain Res. 154(2): 199-209.
  • Fujita E, et al. (2006) Oligo-astheno-teratozoospermia in mice lacking RA175/TSLC1/SynCAM/IGSF4A, a cell adhesion molecule in the immunoglobulin superfamily. Mol Cell Biol. 26(2): 718-26.
  • Nowacki S, et al. (2008) Expression of the tumour suppressor gene CADM1 is associated with favourable outcome and inhibits cell survival in neuroblastoma. Oncogene. 27(23): 3329-38.
  • TOP