Mouse SOD1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011434.1

RefSeq ORF Size

465bp

Gene Synonym

Ipo1, SODC, Ipo-1, Sod-1, CuZnSOD, Cu/Zn-SOD, B430204E11Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse superoxide dismutase 1, soluble Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SOD1 belongs to the Cu-Zn superoxide dismutase family. It binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. SOD1 destroys radicals which are normally produced within the cells and which are toxic to biological systems. Defects in SOD1 are the cause of amyotrophic lateral sclerosis type 1 (ALS1). ALS1 is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Sensory abnormalities are absent. Death usually occurs within 2 to 5 years. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of cases leading to familial forms.

References

Murakami K, et al. (2011) SOD1 (copper/zinc superoxide dismutase) deficiency drives amyloid β protein oligomerization and memory loss in mouse model of Alzheimer disease. J Biol Chem. 286(52):44557-68.

Thompson M, et al. (2012) Paradoxical roles of serine racemase and D-serine in the G93A mSOD1 mouse model of amyotrophic lateral sclerosis. J Neurochem. 120(4):598-610.

Magrané J, et al. (2012) Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons. J Neurosci. 32(1):229-42.

Gertz B, et al. (2012) Nuclear localization of human SOD1 and mutant SOD1-specific disruption of survival motor neuron protein complex in transgenic amyotrophic lateral sclerosis mice. J Neuropathol Exp Neurol. 71(2):162-77.

Catalog Number:MGH314-NM