Mouse SOD1 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:MGH314-NH

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
465bp
Gene Synonym
Ipo1, SODC, Ipo-1, Sod-1, CuZnSOD, Cu/Zn-SOD, B430204E11Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse superoxide dismutase 1, soluble Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SOD1 belongs to the Cu-Zn superoxide dismutase family. It binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. SOD1 destroys radicals which are normally produced within the cells and which are toxic to biological systems. Defects in SOD1 are the cause of amyotrophic lateral sclerosis type 1 (ALS1). ALS1 is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Sensory abnormalities are absent. Death usually occurs within 2 to 5 years. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of cases leading to familial forms.
References
  • Murakami K, et al. (2011) SOD1 (copper/zinc superoxide dismutase) deficiency drives amyloid β protein oligomerization and memory loss in mouse model of Alzheimer disease. J Biol Chem. 286(52):44557-68.
  • Thompson M, et al. (2012) Paradoxical roles of serine racemase and D-serine in the G93A mSOD1 mouse model of amyotrophic lateral sclerosis. J Neurochem. 120(4):598-610.
  • Magrané J, et al. (2012) Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons. J Neurosci. 32(1):229-42.
  • Gertz B, et al. (2012) Nuclear localization of human SOD1 and mutant SOD1-specific disruption of survival motor neuron protein complex in transgenic amyotrophic lateral sclerosis mice. J Neuropathol Exp Neurol. 71(2):162-77.
  • TOP