Mouse SNCA/alpha-Synuclein Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001042451.2

RefSeq ORF Size

468 bp

Gene Synonym

NACP; alphaSYN

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse synuclein, alpha Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

HindIII + NotI(6kb+0.47kb)

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Alpha-Synuclein (alpha-Syn), also known as NACP or SNCA, exists as at least two structural isoforms: one is helix-rich, membrane-bound form that both the N- and C-terminal regions of alpha-synuclein are tightly associated with membranes and the other is disordered, cytosolic form. Synuclein is found predominantly in the presynaptic termini, in both free or membrane-bound forms. SNCA is extensively localized in nucleus of neurons. It has been shown that alpha-Synuclein was highly expressed in the mitochondria in olfactory bulb, hippocampus, striatum, and thalamus, where the cytosolic alpha-Synuclein was also rich. Normally the unstructured soluble type of alpha-synuclein can aggregate to form insoluble fibrils in pathological conditions characterized by Lewy bodies, such as Parkinson's disease, dementia with Lewy bodies and multiple system atrophy. SNCA abnormality and mitochondrial deficiency are two major changes in the brain of patients with Parkinson's disease (PD). In addition, alpha-synuclein is an abundant component of Lewy bodies in sporadic Parkinson's disease and diffuse Lewy body disease.

References

Arima K, et al. (1998) Immunoelectron-microscopic demonstration of NACP / alpha-synuclein-epitopes onthe filamentous component of Lewy bodies in Parkinson's disease and in dementia with Lewy bodies. Brain Res. 808 (1): 93-100.

Arima K, et al. (1998) NACP / alpha-synuclein immunoreactivity in fibrillary components of neuronal and oligodendroglial cytoplasmic inclusions in the pontine nuclei in multiple system atrophy. Acta Neuropathol. 96 (5): 439-44.

Lee HJ, et al. (2001) Membrane-bound alpha-Synuclein Has a High Aggregation Propensity and the Ability to Seed the Aggregation of the Cytosolic Form. The Journal of Biological Chemistry. 277: 671-8.

Catalog Number:MGH269-NM