Mouse SNCA/alpha-Synuclein Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001042451.2

RefSeq ORF Size

468 bp

Gene Synonym

NACP; alphaSYN

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse synuclein, alpha Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

HindIII + NotI(6kb+0.47kb)

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Alpha-Synuclein (alpha-Syn), also known as NACP or SNCA, exists as at least two structural isoforms: one is helix-rich, membrane-bound form that both the N- and C-terminal regions of alpha-synuclein are tightly associated with membranes and the other is disordered, cytosolic form. Synuclein is found predominantly in the presynaptic termini, in both free or membrane-bound forms. SNCA is extensively localized in nucleus of neurons. It has been shown that alpha-Synuclein was highly expressed in the mitochondria in olfactory bulb, hippocampus, striatum, and thalamus, where the cytosolic alpha-Synuclein was also rich. Normally the unstructured soluble type of alpha-synuclein can aggregate to form insoluble fibrils in pathological conditions characterized by Lewy bodies, such as Parkinson's disease, dementia with Lewy bodies and multiple system atrophy. SNCA abnormality and mitochondrial deficiency are two major changes in the brain of patients with Parkinson's disease (PD). In addition, alpha-synuclein is an abundant component of Lewy bodies in sporadic Parkinson's disease and diffuse Lewy body disease.

References

Arima K, et al. (1998) Immunoelectron-microscopic demonstration of NACP / alpha-synuclein-epitopes onthe filamentous component of Lewy bodies in Parkinson's disease and in dementia with Lewy bodies. Brain Res. 808 (1): 93-100.

Arima K, et al. (1998) NACP / alpha-synuclein immunoreactivity in fibrillary components of neuronal and oligodendroglial cytoplasmic inclusions in the pontine nuclei in multiple system atrophy. Acta Neuropathol. 96 (5): 439-44.

Lee HJ, et al. (2001) Membrane-bound alpha-Synuclein Has a High Aggregation Propensity and the Ability to Seed the Aggregation of the Cytosolic Form. The Journal of Biological Chemistry. 277: 671-8.

Catalog Number:MGH269-CY