Mouse SIGLEC5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGH050-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1710bp
Gene Synonym
Siglecf, mSiglec-F
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse sialic acid binding Ig-like lectin 5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SIGLEC5 contains 2 Ig-like C2-type (immunoglobulin-like) domains and 1 Ig-like V-type (immunoglobulin-like) domain. It belongs to the immunoglobulin superfamily and SIGLEC (sialic acid binding Ig-like lectin) family. SIGLEC5 is expressed by monocytic/myeloid lineage cells. It is found at high levels in peripheral blood leukocytes, spleen, bone marrow and at lower levels in lymph node, lung, appendix, placenta, pancreas and thymus. It is also expressed by monocytes and neutrophils but absent from leukemic cell lines representing early stages of myelomonocytic differentiation. SIGLEC5 is a putative adhesion molecule that mediates sialic-acid dependent binding to cells. It binds equally to alpha-2,3-linked and alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface.
References
  • Angata T, et al. (2006) Discovery of Siglec-14, a novel sialic acid receptor undergoing concerted evolution with Siglec-5 in primates. FASEB J. 20(12):1964-73.
  • Avril T, et al. (2005) Siglec-5 (CD170) can mediate inhibitory signaling in the absence of immunoreceptor tyrosine-based inhibitory motif phosphorylation. J Biol Chem. 280(20):19843-51.
  • Erickson-Miller CL, et al. (2003) Characterization of Siglec-5 (CD170) expression and functional activity of anti-Siglec-5 antibodies on human phagocytes. Exp Hematol. 31(5):382-8.
  • TOP